The Seat of Singular Gene Choice: Dissecting the Role of Odorant Receptor Enhancer Elements That Lead to Mammalian Olfactory System Expression

Author

Alessandro M. Rosa, The Graduate Center, City University of New YorkFollow

Date of Degree

9-2024

Document Type

Dissertation

Degree Name

Ph.D.

Program

Biology

Advisor

Paul Feinstein

Committee Members

Mitchell Goldfarb

Thomas Bozza

Jayne Raper

Mark Emerson

Subject Categories

Biology | Molecular Biology | Molecular Genetics

Keywords

Olfactory Receptor Genes, Gene Regulation, Lhx2, Enhancer Elements

Abstract

Odorant receptors (ORs) were first identified in 1991 and the initial data strongly suggested that ORs were part of a large superfamily of G-protein-coupled receptors. Within a few years of the discovery of the OR superfamily, it became clear that each OR allele was exclusively expressed in olfactory sensory neurons (OSN), and that this singular expression leads to cellular identity. Many studies over the past thirty years have sought to unlock the mysteries of the mechanism for monoallelic and monogenic OR gene activation and expression in OSNs, however no definitive model for singular gene expression has emerged.

Using a series of β-galactosidase (LacZ) mini promoter-reporter transgenes, we dissect the elements of known OR promoters and enhancers to characterize necessity and sufficiency for singular OR gene choice. Here, we provide evidence that a multimerized, 21 base pair (bp) recognition sequence (ACATAACTTTTTAATGAGTCT) added to a non-OR promoter is sufficient to produce OSN-specific, punctate expression of a reporter cassette in mature OSNs. The observed expression pattern of the reporter cassette recapitulates that of transcribed OR genes. Motif analysis of the 21bp sequence reveals a known binding site for the LIM homeobox 2 transcriptional regulator protein (Lhx2), TAATGA, which has been experimentally shown to be necessary for expression of OR genes in OSNs. Using genomic analysis, we demonstrate that the core Lhx2 binding motif is common not only to most all OR genes but is also abundant throughout the entire genome and is not specific to the olfactory sub-genome. This finding is consistent with the idea that bound OR-like enhancer elements within the genome (based on published ChIP-seq data) alone are insufficient to produce the specificity necessary to generate singular, monoallelic OR gene choice in OSNs.

Phylogenetic analysis of the regulatory elements of trace amine-associated receptor (TAAR) genes presented herein identifies two regions of homology conserved across mammals that are necessary and sufficient for singular gene choice in TAAR-expressing OSNs. Surprisingly, conserved Lhx2 sites are a component of these elements, despite published suggestions that TAAR gene regulation and OR gene regulation have distinct mechanisms.

While much of the research into gene regulation, including the experimental data present herein, focuses on genetic motifs, singularity inevitably must be a function of protein aggregates acting on genes. The question then becomes how those protein aggregates form to regulate gene expression. The currently accepted model suggests the coalescence of bound OR enhancers generating a super-enhancer that can activate a single OR allele. In part, this model relies on competition between multiple super-enhancers within a single OSN nucleus, yielding one winner, resulting in the expression of the identifying OR, with all other competitors being silenced. Conversely, singularity could be an emergent property of the OSN, where a nuclear protein complex exists independent of chromatin, that allows only one OR allele to be bound and actively expressed. Collectively, our data suggests the alternative OR gene choice hypothesis; the existence of a solitary transcriptional structure within the nucleus of OSNs, likely a unique protein aggregate, that selectively attracts high-affinity Lhx2 sites and maintains the expression of a functional OR-like protein.

Supplement: Re-analysis of ChipSeq of Lhx2 and Ebf1 cobound sites above log2FC>9

Recommended Citation

Rosa, Alessandro M., "The Seat of Singular Gene Choice: Dissecting the Role of Odorant Receptor Enhancer Elements That Lead to Mammalian Olfactory System Expression" (2024). CUNY Academic Works.
https://academicworks.cuny.edu/gc_etds/6017